University of Oxford
Genome Detectives
Join us to explore bacterial DNA sequences
Search

Your final exam.....

Here's where you can earn your Genome Detective Inspector badge... 

detective bacteria

We are curious as to whether this gene has an insertion or deletion within the sequence and wish to investigate further.

The isolate sequence is from Campylobacter.
Gene CAMP0073: Isolate 80378.

One way you can do this is to look at the DNA alignment again in MEGA and see if portions of our new allele sequence (Isolate 80378) match different areas of existing alleles.

1. Download the defined alleles from PubMLST - click here for the guide. The gene we are looking at is CAMP0073. If you struggle with this step, download here.

2. Open the defined alleles in MEGA - click here for the guide.

3. Copy the yellow highlighted sequence from below and paste it into MEGA.

Double click to highlight the whole sequence (it will include the part you have to scroll to) and copy it.

TTTAAAAATAAATCGTATTCCCATAGAAACATATTCCAATAAAACAACTCAAAAAATTAATTCTTAAGGAAAAAGATGAAAACCATTGGTATTATAGGCAGAATGAGTTTTGAAAGCACTATTACTTATTATAAAACAATAAATCAAGCTATAAATGATAAATTAAAATCTTTAAATTCTGCACAAATTTTAACTCAATGTGCTAAAAAATTAGAGCTTGCAGGGGCTAGTTTTATAATAATTGCAACTAATACTATGCATAAGGTTTTTGACAAAATTCAACAAAACATAAATATCCCTATTTTACATATTGCAAAAAGTTCTGCTAAGGCTTTAAAACAAGAAAACATACAAAAAATTGGTTTATTGGGTACTAAATACACAATGACTCAGGATTTTTATAAAAAAGTGCTTATTGAAGAAAATATTAGCGTTATTATTCCTAGCGATGAAGATATAAAAATCGTTAATGATATTATTTTTAATGAGCTTTGCAAAGGTGAAATCAAGCAAGATTCTAAAGAAAAATATTTAAATATTATAAAAAAACTACAAGAAAAAGGGGCAAAAGGAGTGCTTTTAGCTTGCACTGAAATTGGTTTATTAATATCCAAAAATGATACAAATATCAAAATTTTTGACACAAGCCTTATTCACGCCCTTGATGCTGCTAATGAAGCTTTAAAAGATTTATGA

 

 

It can be easier to spot where a sequence goes in and out of alignment using the translated protein sequences view below. 
Alleles and isolate sequence open in MEGA. Shown with colour. Arrows to indicate where the sequence aligns.
Alleles and isolate sequence open in MEGA. Shown without colour. Arrows to indicate where the sequence aligns.

Can you see what has happened? Select your answer below:

Incorrect answer.  The sequence aligns from protein site 60, but there is another place where you might spot some similarities.  Take another look and try again; the clues can be very confusing when you are starting out.

Incorrect answer, but you are very close!  Our new sequence aligns with the existing alleles from protein site 60, and it also looks as though protein sites 26-59 in our new sequence would match with the start of the existing alleles. This puzzle needs some serious brain power if you are new to curation. Take another look and try again. Clue: What would happen if you were to delete superfluous sequence at the start of our gene, and match up the correct start with existing alleles?

Correct answer!  Congratulations on completing the training academy and passing your final exam!  

Here's your Detective Inspector badge:

Image of a cartoon genome detective inspector badge.

This was a tough case to crack, but it will have given you lots of experience for your future assignments.

Click here for the full solution to this final puzzle.

Click here for your course completion certificate.

We hope you have enjoyed the Genome Detectives Training Academy.  If you would like to leave us some feedback please use the form below, or head over to the Zooniverse Genome Detectives forum and leave us a comment.  We would love to know what is good about the site, where it can be improved, and your suggestions for future developments.